login


Cadastre-se aqui
senha
 

Esqueceu sua senha?

Home
Controle de qualidade
Curriculum do diretor
Publicações científicas
Artigos
Genetika na mídia
Localização
Contato
Exames oferecidos
Solicitação de exames
Planos de Saúde
Aconselhamento
Teste de Paternidade
Banco de DNA
Pesquisa genética
Cadastre-se
Sugestão/reclamação
Cadastre seu curriculum
ROL ANS 2016
CBHPM
Galeria de Fotos
Projeto Genoma
CID Doenças genéticas
Associações de apoio
Login



  .: Projeto Genoma Humano - Código Genético

         O quadro abaixo, demonstra uma pequena simulação do que é e como se escreve o Código Genético de um ser vivo. Neste quadro existem 3.672 letras bioquímicas combinadas formando um sequência de bases nitrogenadas, onde A representa a base alanina, T a base timina, C a base citosina e G a base guanina.

CCAACTTAGCGGTTAAAATTCCTCCCTTGGAGGATTACCATGACCGATGATCCGGTAGCCGTAGGCTAGGATCGGA TTGGTTTCGGTAGGCTTAAAGGCCGTAGGGCCAATTATCDGGATTACCCATTAATTATTCGGTTAGAGACCCTTAG GATCCCGTTAGGCTTCGGATTAATCGGTAGGGATTCCGCGTAGGCTTGGTCCGTAGGATCGATCGGTCGGATGCGC TGAGATGGCCTGATCGATCGGTTAAGGTCGGGATGCCGTTAGGGCTGAGAAGTCGATTTCCCYYAAATAACCAGTT GGTTAGGATCCCTAGAGATTCCCGTGGATAGTCGATGCCCGTAGGCTTAGGGATCCCGTAGGCTTAGATCGCTTTA ATCGCCTTAAATTCCTTATTGCTTCGGATAGGCTAGCTAGTCCTCTGATTCGTAGCCCTGATATGGCTCTGAATCC CCAAATTTATGTGGTAAAGTCCCGTAAGCTGGTTTAGGATGCTAAGCTGATCCGTTAAGCTGAAATCGTAGATCGA TAACCCTAGAAGCTTAGGATATAGATCGCCCGTGTAATGAAATTAAGTTATTTTTAAGTGTTTAACTGATAATCGC CTAGATAGCCCTAGAGATCCCGTAAGCTCGATATTAAATTAGGATACCCCTTGGTGGTAAGCTAGTAGTCCTGATA CCTGATGTCCCGAATGCCTTTGGGGTTAGATTTTATTAAGGTATGCTGCTCGATAGCTCGCTCGATAGTCCCGTTA ATAAATTAGCTCGTATATAGCTCTAGATCGCTCGATATAGATCGCTAGATCGTAATTTAAAGTCGCTTTCCCGGGT ATAGAATTCGCTCGATAGATCCCTAGCCCTAGATACGTAGATCGATACCCTGATCCGTAATTGGCCCTTAGATCCC GTAGATATCCCGTAGATCGATCGATCGATATCGCGCTAGATCGATCGTAATCCAAATGCCCTGATAGATCCGTAGT CGATCGTAACGTAGCTCGATCAGTCATCGATCGGTAGCTAAAGTCCGATAGCTAGTCCCGTAAGCTAATCGTAGCT AAGTCCCGTAGCTAAGTCGATCGTAGCTAGCTAGTCCCGTAGCCCTAGAATCGATTTCCCCGTTTTAAAAAGTGAT GCCCTGATCCTAGAATGCCCTTAAACCCTTAAGGATTGGTAGACCATGACCAGTAGATGACCAAGTTCCAACTTAG CGGTTAAAATTCCTCCCTTGGAGGATTACCATGACCGATGATCCGGTAGCCGTAGGCTAGGATCGGATTGGTTTCG GTAGGCTTAAAGGCCGTAGGGCCAATTATCDGGATTACCCATTAATTATTCGGTTAGAGACCCTTAGGATCCCGTT AGGCTTCGGATTAATCGGTAGGGATTCCGCGTAGGCTTGGTCCGTAGGATCGATCGGTCGGATGCGCTGAGATGGC CTGATCGATCGGTTAAGGTCGGGATGCCGTTAGGGCTGAGAAGTCGATTTCCCYYAAATAACCAGTTGGTTAGGAT CCCTAGAGATTCCCGTGGATAGTCGATGCCCGTAGGCTTAGGGATCCCGTAGGCTTAGATCGCTTTAATCGCCTTA AATTCCTTATTGCTTCGGATAGGCTAGCTAGTCCTCTGATTCGTAGCCCTGATATGGCTCTGAATCCCCAAATTTA TGTGGTAAAGTCCCGTAAGCTGGTTTAGGATGCTAAGCTGATCCGTTAAGCTGAAATCGTAGATCGATAACCCTAG AAGCTTAGGATATAGATCGCCCGTGTAATGAAATTAAGTTATTTTTAAGTGTTTAACTGATAATCGCCTAGATAGC CCTAGAGATCCCGTAAGCTCGATATTAAATTAGGATACCCCTTGGTGGTAAGCTAGTAGTCCTGATACCTGATGTC CCGAATGCCTTTGGGGTTAGATTTTATTAAGGTATGCTGCTCGATAGCTCGCTCGATAGTCCCGTTAATAAATTAG CTCGTATATAGCTCTAGATCGCTCGATATAGATCGCTAGATCGTAATTTAAAGTCGCTTTCCCGGGTATAGAATTC GCTCGATAGATCCCTAGCCCTAGATACGTAGATCGATACCCTGATCCGTAATTGGCCCTTAGATCCCGTAGATATC CCGTAGATCGATCGATCGATATCGCGCTAGATCGATCGTAATCCAAATGCCCTGATAGATCCGTAGTCGATCGTAA CGTAGCTCGATCAGTCATCGATCGGTAGCTAAAGTCCGATAGCTAGTCCCGTAAGCTAATCGTAGCTAAGTCCCGT AGCTAAGTCGATCGTAGCTAGCTAGTCCCGTAGCCCTAGAATCGATTTCCCCGTTTTAAAAAGTGATGCCCTGATC CTAGAATGCCCTTAAACCCTTAAGGATTGGTAGACCATGACCAGTAGATGACCAAGTTCCAACTTAGCGGTTAAAA TTCCTCCCTTGGAGGATTACCATGACCGATGATCCGGTAGCCGTAGGCTAGGATCGGATTGGTTTCGGTAGGCTTA AAGGCCGTAGGGCCAATTATCDGGATTACCCATTAATTATTCGGTTAGAGACCCTTAGGATCCCGTTAGGCTTCGG ATTAATCGGTAGGGATTCCGCGTAGGCTTGGTCCGTAGGATCGATCGGTCGGATGCGCTGAGATGGCCTGATCGAT CGGTTAAGGTCGGGATGCCGTTAGGGCTGAGAAGTCGATTTCCCYYAAATAACCAGTTGGTTAGGATCCCTAGAGA TTCCCGTGGATAGTCGATGCCCGTAGGCTTAGGGATCCCGTAGGCTTAGATCGCTTTAATCGCCTTAAATTCCTTA TTGCTTCGGATAGGCTAGCTAGTCCTCTGATTCGTAGCCCTGATATGGCTCTGAATCCCCAAATTTATGTGGTAAA GTCCCGTAAGCTGGTTTAGGATGCTAAGCTGATCCGTTAAGCTGAAATCGTAGATCGATAACCCTAGAAGCTTAGG ATATAGATCGCCCGTGTAATGAAATTAAGTTATTTTTAAGTGTTTAACTGATAATCGCCTAGATAGCCCTAGAGAT CCCGTAAGCTCGATATTAAATTAGGATACCCCTTGGTGGTAAGCTAGTAGTCCTGATACCTGATGTCCCGAATGCC TTTGGGGTTAGATTTTATTAAGGTATGCTGCTCGATAGCTCGCTCGATAGTCCCGTTAATAAATTAGCTCGTATAT AGCTCTAGATCGCTCGATATAGATCGCTAGATCGTAATTTAAAGTCGCTTTCCCGGGTATAGAATTCGCTCGATAG ATCCCTAGCCCTAGATACGTAGATCGATACCCTGATCCGTAATTGGCCCTTAGATCCCGTAGATATCCCGTAGATC GATCGATCGATATCGCGCTAGATCGATCGTAATCCAAATGCCCTGATAGATCCGTAGTCGATCGTAACGTAGCTCG ATCAGTCATCGATCGGTAGCTAAAGTCCGATAGCTAGTCCCGTAAGCTAATCGTAGCTAAGTCCCGTAGCTAAGTC GATCGTAGCTAGCTAGTCCCGTAGCCCTAGAATCGATTTCCCCGTTTTAAAAAGTGATGCCCTGATCCTAGAATGC CCTTAAACCCTTAAGGATTGGTAGACCATGACCAGTAGATGACCAAGTT


[ Voltar ]